si:ch211-109n19.5

Ensembl ID:
ENSDARG00000057248
ZFIN ID:
ZDB-GENE-030131-3278
Human Orthologue:
SCLT1
Human Description:
sodium channel and clathrin linker 1 [Source:HGNC Symbol;Acc:26406]
Mouse Orthologue:
Sclt1
Mouse Description:
sodium channel and clathrin linker 1 Gene [Source:MGI Symbol;Acc:MGI:1914411]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1855 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa1855
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079782 Essential Splice Site 632 683 20 21
ENSDART00000134708   None 178 None 8
ENSDART00000144596   None 114 None 8
ENSDART00000146067 Essential Splice Site 632 683 21 22
Genomic Location (Zv9):
Chromosome 1 (position 11661625)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11678694
KASP Assay ID:
554-1846.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAATATATCCTGTGAGTGATCGAGTCTGYGGTTGTGGTCTTGTGTA[G/A]TTTGAGAGGCAGGTCTCAGAACAGCAGGAGAAGAACACTCGTCTACAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link