tph2

Ensembl ID:
ENSDARG00000057239
ZFIN ID:
ZDB-GENE-040624-4
Description:
tryptophan 5-hydroxylase 2 [Source:RefSeq peptide;Acc:NP_999960]
Human Orthologue:
TPH2
Human Description:
tryptophan hydroxylase 2 [Source:HGNC Symbol;Acc:20692]
Mouse Orthologue:
Tph2
Mouse Description:
tryptophan hydroxylase 2 Gene [Source:MGI Symbol;Acc:MGI:2651811]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8576 Nonsense Mutation detected in F1 DNA During 2014
sa4038 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079832 Nonsense 160 500 4 11
ENSDART00000112627 Nonsense 133 473 4 11
Genomic Location:
Chromosome 18 (position 16657636)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTGTTTGGACTGTGTGTGTGTTTTGGGTGGATTGCCAGATGGGGAA[G/T]GAATACCATGGTTTCCCCAAAAAATCTCAGAGCTGGATCAGTGCTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4038
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079832 Essential Splice Site 279 500 6 11
ENSDART00000112627 Essential Splice Site 252 473 6 11
Genomic Location:
Chromosome 18 (position 16655928)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGGACAACATCCCACAGCTGGAGGACGTGTCTCTATTCTTAAGAGG[T/C]AAAACATGTGAAATGATCGAATTCATCTGCATTTGGTAGCACTTGTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xa1ez3yw