tbc1d15

Ensembl ID:
ENSDARG00000057218
ZFIN ID:
ZDB-GENE-041111-251
Description:
TBC1 domain family member 15 [Source:RefSeq peptide;Acc:NP_001166096]
Human Orthologue:
TBC1D15
Human Description:
TBC1 domain family, member 15 [Source:HGNC Symbol;Acc:25694]
Mouse Orthologue:
Tbc1d15
Mouse Description:
TBC1 domain family, member 15 Gene [Source:MGI Symbol;Acc:MGI:1913937]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13834 Essential Splice Site Available for shipment Available now
sa14248 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079820 Essential Splice Site 64 367 3 16
ENSDART00000079824 Essential Splice Site 64 664 3 17
ENSDART00000129146 Essential Splice Site 64 664 3 17
Genomic Location:
Chromosome 18 (position 16676042)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACCCCTAGAGGATGCAGATCCCTCAAACATGYTGTGTGCCTGCAAGG[T/C]TTGTTAGTTYACTCATCTGTGAGAGTTWGCATATTTAAATTGACTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079820 Nonsense 114 367 5 16
ENSDART00000079824 Nonsense 114 664 5 17
ENSDART00000129146 Nonsense 114 664 5 17
Genomic Location:
Chromosome 18 (position 16675566)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNAATCTAAAACGGTAACTAAGTGYATTATTTATTTTGACAGGTGGAT[C/A]AAATCACGTGAATGAACAGAACAAGCGAGCTTTCTCTTTTAATSTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ppttdlev