tbc1d15

Ensembl ID:
ENSDARG00000057218
ZFIN ID:
ZDB-GENE-041111-251
Description:
TBC1 domain family member 15 [Source:RefSeq peptide;Acc:NP_001166096]
Human Orthologue:
TBC1D15
Human Description:
TBC1 domain family, member 15 [Source:HGNC Symbol;Acc:25694]
Mouse Orthologue:
Tbc1d15
Mouse Description:
TBC1 domain family, member 15 Gene [Source:MGI Symbol;Acc:MGI:1913937]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13834 Essential Splice Site Available for shipment Available now
sa14248 Nonsense Available for shipment Available now
sa43074 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa13834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079820 Essential Splice Site 64 367 3 16
ENSDART00000079824 Essential Splice Site 64 664 3 17
ENSDART00000129146 Essential Splice Site 64 664 3 17
Genomic Location (Zv9):
Chromosome 18 (position 16676042)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17027808
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAACCCCTAGAGGATGCAGATCCCTCAAACATGYTGTGTGCCTGCAAGG[T/C]TTGTTAGTTYACTCATCTGTGAGAGTTWGCATATTTAAATTGACTGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14248
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079820 Nonsense 114 367 5 16
ENSDART00000079824 Nonsense 114 664 5 17
ENSDART00000129146 Nonsense 114 664 5 17
Genomic Location (Zv9):
Chromosome 18 (position 16675566)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17027332
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNAATCTAAAACGGTAACTAAGTGYATTATTTATTTTGACAGGTGGAT[C/A]AAATCACGTGAATGAACAGAACAAGCGAGCTTTCTCTTTTAATSTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079820 Essential Splice Site 358 367 9 16
ENSDART00000079824 Essential Splice Site 358 664 9 17
ENSDART00000129146 Essential Splice Site 358 664 9 17
Genomic Location (Zv9):
Chromosome 18 (position 16667041)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17018807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGAGCAGCACTCATGAAGAAAGAAAGCTCCTGCAAAAGAGAAAAACG[T/A]ATGCTTGTTTTTCCTCAGAGAACAGAAAGCATTTGACTTTGACTTTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link