si:dkey-108c13.2

Ensembl ID:
ENSDARG00000057209
ZFIN ID:
ZDB-GENE-070705-281
Description:
hypothetical protein LOC100006660 [Source:RefSeq peptide;Acc:NP_001121841]
Human Orthologue:
AL161744.1
Human Description:
Lipid phosphate phosphatase-related protein type 5 [Source:UniProtKB/Swiss-Prot;Acc:Q32ZL2]
Mouse Orthologue:
4833424O15Rik
Mouse Description:
RIKEN cDNA 4833424O15 gene Gene [Source:MGI Symbol;Acc:MGI:1923019]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39806 Nonsense Mutation detected in F1 DNA During 2017
sa32885 Nonsense Mutation detected in F1 DNA During 2017
sa39805 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125531 Nonsense 144 309 3 6
Genomic Location (Zv9):
Chromosome 2 (position 18811349)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20640080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGGCAGGTGGTGACAGGAAATCTTTCTCCATACTTCCTGACGGTGTG[C/A]AAACCCAACTACACAGCACTGGGGTGCCAACAGGTGGTGCGTTTCATCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32885
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125531 Nonsense 221 309 4 6
Genomic Location (Zv9):
Chromosome 2 (position 18799137)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20627868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAAGGGACACGGCTGGCCAAGCCGGTGCTCTCTCTGGGGCTCATGTG[T/A]CTGGCCTTCCTAACTGGGATTAATCGAGTGGTGGAGTATCGAAACCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39805
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125531 Nonsense 264 309 5 6
Genomic Location (Zv9):
Chromosome 2 (position 18788427)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20617158
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCCCTACGGGTGTTCTGGTTTTAGGTGGTGTGTGTGGTGAAGAATTTC[A/T]AAGGGAAGCCCTTACTGAGTGAGATCCCACCAGAGGAGAGTGTATCCAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link