il17c

Ensembl ID:
ENSDARG00000057180
ZFIN ID:
ZDB-GENE-061031-5
Description:
interleukin 17c [Source:RefSeq peptide;Acc:NP_001018624]
Human Orthologues:
IL17C, IL25
Human Descriptions:
interleukin 17C [Source:HGNC Symbol;Acc:5983]
interleukin 25 [Source:HGNC Symbol;Acc:13765]
Mouse Orthologues:
Il17c, Il25
Mouse Descriptions:
interleukin 17C Gene [Source:MGI Symbol;Acc:MGI:2446486]
interleukin 25 Gene [Source:MGI Symbol;Acc:MGI:2155888]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8464 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111821 Essential Splice Site 2 160 1 3
Genomic Location (Zv9):
Chromosome 18 (position 16736757)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17088523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTATTTAACAATYACTCCGAGTCACTTTTGATATTAAACTATGTGGG[T/C]AAGTAGCAAAAGAAACTTTACAGCWGTGATTATTTTACAGAAATAAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link