abca4a

Ensembl ID:
ENSDARG00000057169
ZFIN ID:
ZDB-GENE-050517-3
Description:
ATP-binding cassette, sub-family A (ABC1), member 4a [Source:RefSeq peptide;Acc:NP_001002206]
Human Orthologue:
ABCA4
Human Description:
ATP-binding cassette, sub-family A (ABC1), member 4 [Source:HGNC Symbol;Acc:34]
Mouse Orthologue:
Abca4
Mouse Description:
ATP-binding cassette, sub-family A (ABC1), member 4 Gene [Source:MGI Symbol;Acc:MGI:109424]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11328 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11328
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079770 Essential Splice Site None 280 1 8
ENSDART00000136772 None None 2277 None 48
ENSDART00000147063 Essential Splice Site None 300 1 7
Genomic Location:
Chromosome 24 (position 29483657)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCATGAGCTTCAGCAGAAGCAAGCACAAAAGAGCCTTCTTCTCCTGAG[G/A]TGAGTCTTGCCACTGTTACMATTTTTACGWGTGTCTTTTAGTYGTTTCCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1lkunjce