eif4g2b

Ensembl ID:
ENSDARG00000057167
ZFIN ID:
ZDB-GENE-030131-6550
Description:
eukaryotic translation initiation factor 4, gamma 2b [Source:RefSeq peptide;Acc:NP_001013461]
Human Orthologue:
EIF4G2
Human Description:
eukaryotic translation initiation factor 4 gamma, 2 [Source:HGNC Symbol;Acc:3297]
Mouse Orthologue:
Eif4g2
Mouse Description:
eukaryotic translation initiation factor 4, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:109207]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23269 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23269
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079758 Nonsense 231 898 9 21
ENSDART00000146163   None 151 None 4

The following transcripts of ENSDARG00000057167 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 16379295)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16731061
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCAGTGATTTTAAGGGGGTCATCACTTCTACTTTATCTGTAGCTTT[T/A]GGAGAAAAAGAAGAGGGTCCAGCTCAAGGACATGGGAGAGGATCTGGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link