ankrd29

Ensembl ID:
ENSDARG00000057159
ZFIN ID:
ZDB-GENE-050208-655
Description:
Ankyrin repeat domain-containing protein 29 [Source:UniProtKB/Swiss-Prot;Acc:Q502M6]
Human Orthologue:
ANKRD29
Human Description:
ankyrin repeat domain 29 [Source:HGNC Symbol;Acc:27110]
Mouse Orthologue:
Ankrd29
Mouse Description:
ankyrin repeat domain 29 Gene [Source:MGI Symbol;Acc:MGI:2687055]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39366 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24131 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39366
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009360 Essential Splice Site 107 298 4 10
Genomic Location:
Chromosome 22 (position 16646597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCAAGCTCCTCTTTGAATTCGGGGCGTCCACTGAGTTTCAGACAAAG[G/A]TGAGCTATCATAATTCACCTTTTTACTAGTGCGTTTCAAATTATGGGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009360 Essential Splice Site 107 298 4 10
Genomic Location:
Chromosome 22 (position 16646598)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAAGCTCCTCTTTGAATTCGGGGCGTCCACTGAGTTTCAGACAAAGG[T/C]GAGCTATCATAATTCACCTTTTTACTAGTGCGTTTCAAATTATGGGTCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link