
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ankrd29
- Ensembl ID:
- ENSDARG00000057159
- ZFIN ID:
- ZDB-GENE-050208-655
- Description:
- Ankyrin repeat domain-containing protein 29 [Source:UniProtKB/Swiss-Prot;Acc:Q502M6]
- Human Orthologue:
- ANKRD29
- Human Description:
- ankyrin repeat domain 29 [Source:HGNC Symbol;Acc:27110]
- Mouse Orthologue:
- Ankrd29
- Mouse Description:
- ankyrin repeat domain 29 Gene [Source:MGI Symbol;Acc:MGI:2687055]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa39366 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa24131 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa39366
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009360 | Essential Splice Site | 107 | 298 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16646597)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16398355 GRCz11 22 16424625 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGTCAAGCTCCTCTTTGAATTCGGGGCGTCCACTGAGTTTCAGACAAAG[G/A]TGAGCTATCATAATTCACCTTTTTACTAGTGCGTTTCAAATTATGGGTCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24131
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000009360 | Essential Splice Site | 107 | 298 | 4 | 10 |
- Genomic Location (Zv9):
- Chromosome 22 (position 16646598)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 16398356 GRCz11 22 16424626 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTCAAGCTCCTCTTTGAATTCGGGGCGTCCACTGAGTTTCAGACAAAGG[T/C]GAGCTATCATAATTCACCTTTTTACTAGTGCGTTTCAAATTATGGGTCGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: