NP_001012260.1

Ensembl ID:
ENSDARG00000057155
Description:
XK-related protein 5 [Source:RefSeq peptide;Acc:NP_001012260]
Human Orthologue:
XKR5
Human Description:
XK, Kell blood group complex subunit-related family, member 5 [Source:HGNC Symbol;Acc:20782]
Mouse Orthologue:
Xkr5
Mouse Description:
X Kell blood group precursor-related family, member 5 Gene [Source:MGI Symbol;Acc:MGI:2442327]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29464 Nonsense Mutation detected in F1 DNA During 2017
sa37161 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29464
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097881 Nonsense 198 621 5 11
ENSDART00000123762 Nonsense 223 633 4 7
Genomic Location (Zv9):
Chromosome 20 (position 48771774)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47623154
KASP Assay ID:
2261-4937.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGGCCCGCTTCACCAGCCTCGCCCTGTTCACCCGCACCTTCGGCTGCT[G/A]GCTCATCGGGGTCATCGGTGAGTCTGAGACACAGGAGATTATATACATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37161
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097881 Nonsense 207 621 6 11
ENSDART00000123762 Nonsense 232 633 5 7
Genomic Location (Zv9):
Chromosome 20 (position 48774436)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47625816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCTCCCAATTCATGTGATGTATGCTTCTATTTCTCAGCGTCTCATTG[G/A]CTGATGGCAGCGCTGTGGTTGGTCTCCCAACAGACGGACATATATGTAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link