prep

Ensembl ID:
ENSDARG00000057151
ZFIN ID:
ZDB-GENE-050522-14
Description:
prolyl endopeptidase [Source:RefSeq peptide;Acc:NP_001018589]
Human Orthologue:
PREP
Human Description:
prolyl endopeptidase [Source:HGNC Symbol;Acc:9358]
Mouse Orthologue:
Prep
Mouse Description:
prolyl endopeptidase Gene [Source:MGI Symbol;Acc:MGI:1270863]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3079 Nonsense F2 line generated During 2017
sa5677 Nonsense F2 line generated During 2017
sa23810 Essential Splice Site Available for shipment Available now
sa43533 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa3079
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115010 Nonsense 174 709 5 15
ENSDART00000115010 Nonsense 174 709 5 15
Genomic Location (Zv9):
Chromosome 20 (position 48723809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48623901
KASP Assay ID:
554-3074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGTGCTGTCCTGCTAGAGGATCGACTAGAGAGGGTCAAATTTACATG[C/A]ATGTCCTGGACTCATGATGGAAAGGGCCTTTTCTACAACTCTTATCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5677
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115010 Nonsense 174 709 5 15
ENSDART00000115010 Nonsense 174 709 5 15
Genomic Location (Zv9):
Chromosome 20 (position 48723809)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48623901
KASP Assay ID:
554-3074.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGGTGCTGTCCTGCTAGAGGATCGACTAGAGAGGGTCAAATTTACATG[C/A]ATGTCCTGGACTCATGATGGAAAGGGCCTTTTCTACAACTCTTATCCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23810
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115010 Essential Splice Site 238 709 6 15
Genomic Location (Zv9):
Chromosome 20 (position 48721635)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48621727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGTGTGCTGAATTTCCAGATGAGCCCAAATGGATGAGCGGTGTTGAG[G/A]TAACAGACATGCATACAAACTGCACTCCATTTCTGGTCCAGTTAAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43533
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115010 Nonsense 434 709 10 15
Genomic Location (Zv9):
Chromosome 20 (position 48713973)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 48614065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCATGTTTTCAGAGAGGTCACAGTGAAGGGCTTCAATCCGGCCGACTA[T/A]CAGACCACTCAGGTACAGAAAGACACTTACAGATGCTTTATCTCTGGCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link