ngfr

Ensembl ID:
ENSDARG00000057143
ZFIN ID:
ZDB-GENE-030131-2537
Human Orthologues:
LTBR, TNFRSF11A, TNFRSF4
Human Descriptions:
lymphotoxin beta receptor (TNFR superfamily, member 3) [Source:HGNC Symbol;Acc:6718]
tumor necrosis factor receptor superfamily, member 11a, NFKB activator [Source:HGNC Symbol;Acc:11908
tumor necrosis factor receptor superfamily, member 4 [Source:HGNC Symbol;Acc:11918]
Mouse Orthologues:
Ltbr, Tnfrsf11a, Tnfrsf4
Mouse Descriptions:
lymphotoxin B receptor Gene [Source:MGI Symbol;Acc:MGI:104875]
tumor necrosis factor receptor superfamily, member 11a Gene [Source:MGI Symbol;Acc:MGI:1314891]
tumor necrosis factor receptor superfamily, member 4 Gene [Source:MGI Symbol;Acc:MGI:104512]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39087 Nonsense Mutation detected in F1 DNA During 2017
sa9547 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022685 Nonsense 376 413 6 6
Genomic Location (Zv9):
Chromosome 16 (position 18368978)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16410215
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGTCTTTGGACGGGGCCAGGACCCCATCCACACCCTCATGACCGATT[G/A]GTCCCAGCAGGAAGGCTCCACATTGGGTTTGTTGTGTTCAGCTCTGACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9547
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022685 Nonsense 376 413 6 6
Genomic Location (Zv9):
Chromosome 16 (position 18368977)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 16410214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACGTCTTTGGACGGGGCCAGGACCCCAWCCACACCCTCATGACCGATTG[G/A]TCCCAGCAGGAAGGCTCCACATTGGGTTTGTTGTGTTCAGCTCTGACTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link