hadha

Ensembl ID:
ENSDARG00000057128
ZFIN ID:
ZDB-GENE-031222-5
Description:
hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase, alph
Human Orthologue:
HADHA
Human Description:
hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), a
Mouse Orthologue:
Hadha
Mouse Description:
hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trif

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa414 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079734 Nonsense 638 761 18 20
ENSDART00000126238 Nonsense 618 741 17 19
Genomic Location:
Chromosome 20 (position 48653279)
KASP Assay ID:
554-0274.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTATCTGCACTTCAGGACGCAAGTCTGGAAAGGGTTGTTATGTGTAC[G/T]GAGCCAAGTCAAAAGAAAAGAAAGTGAACTCAGAAGCTGAAGAAATTCTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dj1wob5f