si:dkey-83f6.3

Ensembl ID:
ENSDARG00000057125
ZFIN ID:
ZDB-GENE-091117-48
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JRG3]
Human Orthologue:
PLD1
Human Description:
phospholipase D1, phosphatidylcholine-specific [Source:HGNC Symbol;Acc:9067]
Mouse Orthologue:
Pld1
Mouse Description:
phospholipase D1 Gene [Source:MGI Symbol;Acc:MGI:109585]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6775 Nonsense Mutation detected in F1 DNA During 2014
sa14680 Nonsense Available for shipment Available now
sa1311 Nonsense Available for shipment Available now
sa4273 Essential Splice Site Mutation detected in F1 DNA During 2014
sa5079 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 65 1042 2 25
ENSDART00000124580 Nonsense 61 359 2 9
Genomic Location:
Chromosome 24 (position 27509109)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTCCCGCATCCCCTTYTCAGCTGTATATAAAACCAAAGGCTTTAAA[G/T]AGCCCGGTGCGCGWGTGTTTCTCACMGCGCTCCCCATCACCGCCAAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 259 1042 7 25
ENSDART00000124580 Nonsense 255 359 7 9
Genomic Location:
Chromosome 24 (position 27502746)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTATTCCTGGACTGAACTGCTGTGGCCACAGCAAAATGTGCTACCGCTG[G/A]TCCAAACGGTCAGTTTTATTTTCTAAAAGAACAAAAATAAWTGTGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 356 1042 9 25
ENSDART00000124580 Nonsense 352 359 9 9
Genomic Location:
Chromosome 24 (position 27501504)
KASP Assay ID:
554-1226.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGGCAGCAACTTCCTTAAAGATCATCGCTTCGGGTCCTTCGCCAATGAA[C/T]AGAAGAACATCCTRTCTAAATGGTAAATATCACTTTTTACATGCATTCCC
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Stage Entity Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
heart contraction
GO:0060047

decreased rate
PATO:0000911
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
larval locomotory behavior
GO:0008345

absent
PATO:0000462
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
whole organism
ZFA:0001094
anterior/posterior axis
BSPO:0000013
curved
PATO:0000406
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
24:21180101-21180600 21180621 1 1.40 × 10-24 -1.9 0 hhatlb ENSDARG00000005139
20:10151611-10152000 10151611 -1 3.14 × 10-12 -1.3 6 zgc:86709 ENSDARG00000057911
13:24507801-24508332 24508332 1 6.65 × 10-12 -0.6 0 acta1b ENSDARG00000055618
1:54519801-54520283 54520283 1 3.12 × 10-10 -0.8 -3 acta1a ENSDARG00000036371
7:40784901-40785585 40785585 1 1.48 × 10-08 -0.6 -2 tnni2b.2 ENSDARG00000029995

Mutation Details

Allele Name:
sa4273
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Essential Splice Site 391 1042 10 25
ENSDART00000124580 None None 359 None 9
Genomic Location:
Chromosome 24 (position 27498047)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATGCGCTGGAGGAGGCAGAGGAGGAGATCTTCATCACCGACTGGTGG[T/A]ATGTTCTGATAAAACCTTCTTTTGGTACTATTGATTCAGGGTAGAATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5079
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079726 Nonsense 786 1042 20 25
ENSDART00000124580 None None 359 None 9
Genomic Location:
Chromosome 24 (position 27480436)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTCTGTGTGTGTGTGTGNNNNNNGTTGGCAGGGATGGTAAAAAGTWCCGTGTGTA[T/A]GTGGTGACGCCGCTGCTGCCTGGGTTTGAGGGTGACATTAACACTGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/affgeoa9