si:ch211-22d5.4

Ensembl ID:
ENSDARG00000057113
ZFIN ID:
ZDB-GENE-100513-4
Description:
complement component 6 [Source:RefSeq peptide;Acc:NP_956932]
Human Orthologue:
C6
Human Description:
complement component 6 [Source:HGNC Symbol;Acc:1339]
Mouse Orthologue:
C6
Mouse Description:
complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29570 Nonsense Mutation detected in F1 DNA During 2017
sa29569 Essential Splice Site Mutation detected in F1 DNA During 2017
sa37284 Nonsense Mutation detected in F1 DNA During 2017
sa11761 Nonsense Available for shipment Available now
sa23913 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29570
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079709 Nonsense 15 885 2 18
ENSDART00000138155 Nonsense 35 907 2 18

The following transcripts of ENSDARG00000057113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19757405)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20892894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCACTATGGGGTGTTTCTGTGATCATTACCCATGGAGTACCTGGTCC[C/T]AATGCACTAAAACCTGTGATTCTGGTACTCAATCACGTTTAAGGTAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079709 Essential Splice Site 130 885 4 18
ENSDART00000138155 Essential Splice Site 150 907 4 18

The following transcripts of ENSDARG00000057113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19755284)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20890773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCGGGATTGAGCCTTTGAACTGTAAAGACAAGTTCACCTGTGACACTGG[T/C]ACATCAGCAACTTCTGCTACATAATCTACTGATCTAGCAAGTTTGTACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079709 Nonsense 399 885 10 18
ENSDART00000138155 Nonsense 419 907 10 18

The following transcripts of ENSDARG00000057113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19750637)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20886126
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTAAAAGCATCAGAGAGGTGTATCACATCTGTACAAGGAGGACGAACT[G/T]AATTTGCAGCAGCACTGGCCTGGGAGAAGAAAGGCGTTTCGCCACAGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11761
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079709 Nonsense 636 885 14 18
ENSDART00000138155 Nonsense 657 907 14 18

The following transcripts of ENSDARG00000057113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19747522)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20883011
KASP Assay ID:
2261-5510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTATTTGCTTCACTGGATTTGAGTTGCAGGGATTCCAGCTCATTCATTG[T/A]TTGCAGGATGGTACCTGGGAGAAACCAAAGGCACAGTGTATTAGTAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079709 Nonsense 838 885 18 18
ENSDART00000138155 Nonsense 860 907 18 18

The following transcripts of ENSDARG00000057113 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 19743653)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20879142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTCTTCTTAGTGTCCAAAACGTGTGAGTGTAAGATGCCCAGAGAATG[T/A]CCAAAAGACGGGAAGAAAATATACTGCCTGAAAATCGTGAGGACGCAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link