ENSDARG00000057107

Ensembl ID:
ENSDARG00000057107
Human Orthologues:
ARHGEF6, ARHGEF7
Human Descriptions:
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 [Source:HGNC Symbol;Acc:685]
Rho guanine nucleotide exchange factor (GEF) 7 [Source:HGNC Symbol;Acc:15607]
Mouse Orthologues:
Arhgef6, Arhgef7
Mouse Descriptions:
Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI Symbol;Acc:MGI:1920591]
Rho guanine nucleotide exchange factor (GEF7) Gene [Source:MGI Symbol;Acc:MGI:1860493]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44165 Nonsense Mutation detected in F1 DNA During 2017
sa30117 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44165
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079705 Nonsense 144 343 4 10
Genomic Location (Zv9):
Chromosome 24 (position 30618507)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29647598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTCTAGGCCGTTTCCCACAGAAGAGAGTGTTGAGGATGAAGACATTTA[T/A]AACCATCTTGAGGATCTGATAGAGTGAGTCATTTTTCTGTGTCCACTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30117
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079705 Essential Splice Site 277 343 8 10
Genomic Location (Zv9):
Chromosome 24 (position 30605887)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 29634978
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCACAACGCCACAAACCTCTACCAGATCTTCATCAAATACAAAGAAAG[G/A]TGACAGATTTGTTCTTCGTATCTCTTTAAGAGTGAAATCTGTCTCATATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link