nle1

Ensembl ID:
ENSDARG00000057105
ZFIN ID:
ZDB-GENE-050522-321
Description:
notchless protein homolog 1 [Source:RefSeq peptide;Acc:NP_001018418]
Human Orthologue:
NLE1
Human Description:
notchless homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19889]
Mouse Orthologue:
Nle1
Mouse Description:
notchless homolog 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2429770]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21728 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21728
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079703 Essential Splice Site 45 476 2 13
ENSDART00000148333 Essential Splice Site 45 476 1 12
Genomic Location (Zv9):
Chromosome 10 (position 23358739)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 23130032
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCAGTCCGGACAAACTGCAGCTGGTCTGCAATGCGCTCTTACAGAAG[G/A]TAACGTTAGGGACGATGATGAACTGACTGTGGACATAACTTACTGTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link