papss1

Ensembl ID:
ENSDARG00000057099
ZFIN ID:
ZDB-GENE-080721-5
Description:
bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 [Source:RefSeq peptide;Acc:NP_0011221
Human Orthologue:
PAPSS1
Human Description:
3'-phosphoadenosine 5'-phosphosulfate synthase 1 [Source:HGNC Symbol;Acc:8603]
Mouse Orthologue:
Papss1
Mouse Description:
3'-phosphoadenosine 5'-phosphosulfate synthase 1 Gene [Source:MGI Symbol;Acc:MGI:1330587]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32765 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19587 Essential Splice Site Available for shipment Available now
sa39687 Essential Splice Site Mutation detected in F1 DNA During 2017
sa19586 Essential Splice Site Available for shipment Available now
sa39686 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024984   None 624 None 12
ENSDART00000123274 Essential Splice Site 32 815 2 15
Genomic Location (Zv9):
Chromosome 1 (position 51038660)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49887751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTGCAATATTATATTCTAAAGTCTTTTGTATTAATTTTTGTTTTTTC[A/G]GGCAGAAATATTAAGTGCCGTCAAGGTCAACACAGTAAGTACATTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024984 Essential Splice Site 138 624 4 12
ENSDART00000123274 Essential Splice Site 329 815 7 15
Genomic Location (Zv9):
Chromosome 1 (position 51031112)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49880203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGATTTATATGGTCAAATTTGGTAACAGTTCTTTGCTATATTTCTCCA[G/A]GACCGCATGAATGCAAGAAAGATCCATGAAGCTGCTGGCCTGCCGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024984 Essential Splice Site 184 624 5 12
ENSDART00000123274 Essential Splice Site 375 815 8 15
Genomic Location (Zv9):
Chromosome 1 (position 51028974)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49878065
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAGTAAATGTAGTAGTTTTAACAGTAGCTGGTTACTTCCATTGTCCTCA[G/T]GGTTCACAGGGATAGACTCCGAGTATGAAAAACCTGAGGCTCCTGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19586
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024984 Essential Splice Site 299 624 7 12
ENSDART00000123274 Essential Splice Site 490 815 10 15
Genomic Location (Zv9):
Chromosome 1 (position 51026999)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49876090
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAAAGAGAGTTCCTGCAGTGTCTGCACTTCAACTGTCTGCTCGATGG[T/A]GAGAACTTGCTTTCATTTGAACGTTTTAGTCCTGCATATAATCTGGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024984 Nonsense 419 624 10 12
ENSDART00000123274 Nonsense 610 815 13 15
Genomic Location (Zv9):
Chromosome 1 (position 51009949)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 49859040
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATACAGTTAATTAGCTGTTCTTATTTTTAGATGCCGTCTTTGCCTTT[C/T]AACTGCGAAATCCGGTGCATAATGGCCACGCACTGCTCATGCAGGATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link