kdm5ba

Ensembl ID:
ENSDARG00000057093
ZFIN ID:
ZDB-GENE-030131-5379
Description:
lysine (K)-specific demethylase 5Ba [Source:RefSeq peptide;Acc:NP_001121799]
Human Orthologue:
KDM5B
Human Description:
lysine (K)-specific demethylase 5B [Source:HGNC Symbol;Acc:18039]
Mouse Orthologue:
Kdm5b
Mouse Description:
lysine (K)-specific demethylase 5B Gene [Source:MGI Symbol;Acc:MGI:1922855]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7348 Missense Mutation detected in F1 DNA During 2014
sa16159 Nonsense Available for shipment Available now
sa14585 Nonsense Available for shipment Available now
sa21908 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Missense 113 1483 4 29
ENSDART00000135443 Missense 120 1477 5 28
Genomic Location:
Chromosome 11 (position 25757471)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAACATGGAAGTAAACGCGTCCTTTGGTGTCCTCTGTTTCTAGCTGG[T/G]CAAAGAGGAYGGAGGCTTTGATGTGGTCTGTAAAGAGCGGAGATGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 647 1483 15 29
ENSDART00000135443 Nonsense 647 1477 16 28
Genomic Location:
Chromosome 11 (position 25769573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTRATCCCATTGTGTTTGTGCTGTTCTCCAGGGTATGTGGCACTCCCAG[C/T]AGGTTGACTATGATATACTGCCAGATGAGGAAAGGCAGTGTGCTAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1451 1483 28 29
ENSDART00000135443 Nonsense 1447 1477 28 28
Genomic Location:
Chromosome 11 (position 25784159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCCTCTCAGGTAAACTGGGTCCAGTGTGACGGCAGCTGTAACCAGTG[G/A]TTCCACCAGGTCTGTGTGGGAGTGTCTGCTGAGCAGGCYGAAAACGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1463 1483 28 29
ENSDART00000135443 Nonsense 1459 1477 28 28
Genomic Location:
Chromosome 11 (position 25784193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTGTAACCAGTGGTTCCACCAGGTCTGTGTGGGAGTGTCTGCTGAG[C/T]AGGCCGAAAACGAGGACTACATCTGCGTCAGCTGCGCAATAAACGATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w3abnqoz