kdm5ba

Ensembl ID:
ENSDARG00000057093
ZFIN ID:
ZDB-GENE-030131-5379
Description:
lysine (K)-specific demethylase 5Ba [Source:RefSeq peptide;Acc:NP_001121799]
Human Orthologue:
KDM5B
Human Description:
lysine (K)-specific demethylase 5B [Source:HGNC Symbol;Acc:18039]
Mouse Orthologue:
Kdm5b
Mouse Description:
lysine (K)-specific demethylase 5B Gene [Source:MGI Symbol;Acc:MGI:1922855]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7348 Missense Mutation detected in F1 DNA During 2016
sa27786 Essential Splice Site Mutation detected in F1 DNA During 2016
sa16159 Nonsense Available for shipment Available now
sa31828 Nonsense Mutation detected in F1 DNA During 2016
sa38842 Nonsense Mutation detected in F1 DNA During 2016
sa35081 Nonsense Mutation detected in F1 DNA During 2016
sa35082 Nonsense Mutation detected in F1 DNA During 2016
sa14585 Nonsense Available for shipment Available now
sa21908 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7348
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Missense 113 1483 4 29
ENSDART00000135443 Missense 120 1477 5 28
Genomic Location (Zv9):
Chromosome 11 (position 25757471)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24586296
KASP Assay ID:
554-4114.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAAACATGGAAGTAAACGCGTCCTTTGGTGTCCTCTGTTTCTAGCTGG[T/G]CAAAGAGGAYGGAGGCTTTGATGTGGTCTGTAAAGAGCGGAGATGGACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27786
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Essential Splice Site 212 1483 None 29
ENSDART00000135443 Essential Splice Site 219 1477 None 28
Genomic Location (Zv9):
Chromosome 11 (position 25759084)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24587909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGCTATATGATAATCGTGAAACTCTGACATTTACCTTTTTTCCCCAA[A/G]GGGCCGCTGTTTTAAATCAGAACCGGGTGAGGTGTGTGAAAACAAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16159
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 647 1483 15 29
ENSDART00000135443 Nonsense 647 1477 16 28
Genomic Location (Zv9):
Chromosome 11 (position 25769573)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24598398
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTRATCCCATTGTGTTTGTGCTGTTCTCCAGGGTATGTGGCACTCCCAG[C/T]AGGTTGACTATGATATACTGCCAGATGAGGAAAGGCAGTGTGCTAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 761 1483 17 29
ENSDART00000135443 Nonsense 761 1477 18 28
Genomic Location (Zv9):
Chromosome 11 (position 25774095)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24602920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGAGCTCCGCTGTTTGTTGGCAGAAGCAGAGAAGAAAATGTACCCC[G/T]AGACCGACCTGCTAAATGACATGCGTCAGGTCATCCAGAATGCAGATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 826 1483 18 29
ENSDART00000135443 Nonsense 826 1477 19 28
Genomic Location (Zv9):
Chromosome 11 (position 25774394)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24603219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAGGGCATTCATCAATAAGCTATATGACCTTCCCTGTACCATCCGA[C/T]AGGCTCCTTTTTTGAAGGTATTAAAATTTAAAACATCTTGCGTAATTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35081
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1067 1483 22 29
ENSDART00000135443 Nonsense 1067 1477 23 28
Genomic Location (Zv9):
Chromosome 11 (position 25779151)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24607976
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTGTGTTTGTCTTGAAGGTTTTGTGTCCTAGGTGTGAGACGGGATCG[C/T]AGAAGTCCAAGTCTAAAAAGGCGAAGGAAGGCTTGGTACCATGCAAGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1206 1483 23 29
ENSDART00000135443 Nonsense 1206 1477 24 28
Genomic Location (Zv9):
Chromosome 11 (position 25781554)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24610379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCTGAGAAGCCACCCCTGGATAAGGTGCTTCCTCTGCTCGCATCCTTA[C/T]AGCGGATTCGGGTACGGCTTCCTGAGGGCGATGCTCTGCGATATGTGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14585
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1451 1483 28 29
ENSDART00000135443 Nonsense 1447 1477 28 28
Genomic Location (Zv9):
Chromosome 11 (position 25784159)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24612984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGTCCTCTCAGGTAAACTGGGTCCAGTGTGACGGCAGCTGTAACCAGTG[G/A]TTCCACCAGGTCTGTGTGGGAGTGTCTGCTGAGCAGGCYGAAAACGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21908
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058729 Nonsense 1463 1483 28 29
ENSDART00000135443 Nonsense 1459 1477 28 28
Genomic Location (Zv9):
Chromosome 11 (position 25784193)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 24613018
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCTGTAACCAGTGGTTCCACCAGGTCTGTGTGGGAGTGTCTGCTGAG[C/T]AGGCCGAAAACGAGGACTACATCTGCGTCAGCTGCGCAATAAACGATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link