mapksp1

Ensembl ID:
ENSDARG00000057075
ZFIN ID:
ZDB-GENE-050522-345
Description:
Mitogen-activated protein kinase scaffold protein 1 [Source:UniProtKB/Swiss-Prot;Acc:Q503S6]
Human Orthologue:
MAPKSP1
Human Description:
MAPK scaffold protein 1 [Source:HGNC Symbol;Acc:15606]
Mouse Orthologues:
Gm5900, Mapksp1
Mouse Descriptions:
MAPK scaffold protein 1 Gene [Source:MGI Symbol;Acc:MGI:1929467]
predicted pseudogene 5900 Pseudogene [Source:MGI Symbol;Acc:MGI:3643907]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38926 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38926
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079669 Essential Splice Site 35 124 None 7
ENSDART00000146195 Essential Splice Site 49 138 None 7

The following transcripts of ENSDARG00000057075 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 12353885)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12352253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATGCAATTGTGGTGACAGATAGAGATGGGGTCCCTGTAATCAAAGG[T/C]GAAAACCAGATCTCAGATTTTTACATTTTTGTGCACACTACTGGTCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link