rpgrb

Ensembl ID:
ENSDARG00000057074
ZFIN IDs:
ZDB-GENE-081015-2, ZDB-GENE-081015-2
Description:
Retinitis pigmentosa GTPase regulator protein 2 ORF15 [Source:UniProtKB/TrEMBL;Acc:D2X899]
Human Orthologue:
RPGR
Human Description:
retinitis pigmentosa GTPase regulator [Source:HGNC Symbol;Acc:10295]
Mouse Orthologue:
Rpgr
Mouse Description:
retinitis pigmentosa GTPase regulator Gene [Source:MGI Symbol;Acc:MGI:1344037]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21936 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088624 Nonsense 33 1413 2 14
ENSDART00000124471 Nonsense 33 708 2 17
Genomic Location (Zv9):
Chromosome 11 (position 30648420)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29524406
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTTTTGGAAAGAGTAAATTTGCAGACAACGCCCCTAGTAAATTCTGGT[T/A]AAAAAATGATGTACCTTTGCGAATTTCCTGTGGAGATGAGCACACAGCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link