enpep

Ensembl ID:
ENSDARG00000057064
ZFIN ID:
ZDB-GENE-050309-218
Description:
Novel protein similar to glutamyl aminopeptidase (Aminopeptidase A) (ENPEP) [Source:UniProtKB/TrEMBL
Human Orthologue:
ENPEP
Human Description:
glutamyl aminopeptidase (aminopeptidase A) [Source:HGNC Symbol;Acc:3355]
Mouse Orthologue:
Enpep
Mouse Description:
glutamyl aminopeptidase Gene [Source:MGI Symbol;Acc:MGI:106645]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31910 Nonsense Mutation detected in F1 DNA During 2016
sa42155 Nonsense Mutation detected in F1 DNA During 2016
sa4494 Nonsense Mutation detected in F1 DNA During 2016
sa10319 Nonsense Available for shipment Available now
sa5788 Essential Splice Site F2 line generated During 2016
sa2718 Essential Splice Site F2 line generated During 2016
sa35436 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa31910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 148 951 1 20
Genomic Location:
Chromosome 13 (position 12450103)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGCCTTCACTACAGCGCAGCAGCCCGTCTGGTGTGACCTCTGTCAAGT[T/A]GAAGCAATGCTTTGAATACAAGCCGCAGGAGTACGTGGTTGTGGAAGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42155
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 493 951 8 20
Genomic Location:
Chromosome 13 (position 12426075)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCGAATGCTGGAGGACTTACTTGGCCGAGAGACATTTAGGGATGGTTG[T/A]CGAGTAAGGCATCTCACATTTTAACCTACTTTTTCCAGTGGCTCTGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 688 951 14 20
Genomic Location:
Chromosome 13 (position 12419356)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATTTAACAAGATATCTGGCYGAYGAAACCGARTATATTGTGTGGGAT[C/T]GAGTTTCTGCTTCTATCTCCTACGTGAGAGAAATGTTGGCTGATGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Nonsense 816 951 17 20
Genomic Location:
Chromosome 13 (position 12416583)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGTATCTGTCTGCCACYCTGGCCCAGGAGAAAGATAAGCTGCTCTA[T/G]GRYCTGGCTTCAGTCAAAAATATTCATCTGCTTCATAGGTAAACRTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5788
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 829 951 18 20
ENSDART00000079655 Essential Splice Site 829 951 18 20
Genomic Location:
Chromosome 13 (position 12415885)
KASP Assay ID:
554-3396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGAATTRATATAAATTGAAASTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2718
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 829 951 18 20
ENSDART00000079655 Essential Splice Site 829 951 18 20
Genomic Location:
Chromosome 13 (position 12415885)
KASP Assay ID:
554-3396.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAATGAATTRATATAAATTGAAASTATTTCAACATGTTTGTTTTCTAAC[A/T]GGTTGCTTGAAGCCACAAAAAATGAAAGCATCATAAGGAGTCAAGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079655 Essential Splice Site 903 951 19 20
Genomic Location:
Chromosome 13 (position 12413283)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCAGCCAGAATTACAACTACATACAGCTCTAATCTTCAACTGTGGAAG[G/T]TGAGATTTTCTTTTTCTATTCTTTTTTACTTCACTTTAAATGTCCTTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link