lrit3

Ensembl ID:
ENSDARG00000057054
ZFIN ID:
ZDB-GENE-070424-130
Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 [Source:RefSeq peptide;Acc:NP_
Human Orthologue:
LRIT3
Human Description:
leucine-rich repeat, immunoglobulin-like and transmembrane domains 3 [Source:HGNC Symbol;Acc:24783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10245 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102309 Nonsense 337 380 6 6
ENSDART00000102311 Missense 296 438 4 4
Genomic Location:
Chromosome 13 (position 12461094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCTGACCTTTCTTCATCTGCTTTAATGATTACACACATCTCTGCAGA[T/A]GTGCAAGAGTCTCCTCKTGTGGGGGTCCGATGGTCTGTGGTCAGTCTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9nwjaxny