dscaml1

Ensembl ID:
ENSDARG00000057052
Human Orthologue:
DSCAML1
Human Description:
Down syndrome cell adhesion molecule like 1 [Source:HGNC Symbol;Acc:14656]
Mouse Orthologue:
Dscaml1
Mouse Description:
Down syndrome cell adhesion molecule-like 1 Gene [Source:MGI Symbol;Acc:MGI:2150309]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30683 Essential Splice Site Mutation detected in F1 DNA During 2017
sa5877 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44822 Nonsense Mutation detected in F1 DNA During 2017
sa42500 Nonsense Mutation detected in F1 DNA During 2017
sa30989 Nonsense Mutation detected in F1 DNA During 2017
sa39037 Nonsense Mutation detected in F1 DNA During 2017
sa42501 Essential Splice Site Mutation detected in F1 DNA During 2017
sa22596 Nonsense Available for shipment Available now
sa22597 Essential Splice Site Available for shipment Available now
sa32018 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Essential Splice Site 84 2144 1 33
Genomic Location (Zv9):
Chromosome 15 (position 13232974)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12297843
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGCATGTGGCTGGTAACTTTACTCCTGCTGTATTCTTTTCAAGAAGG[T/C]ATGTAGTGAGTTTATTTATTGCGGCTTTTTTATTACTTTATAATGTTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Essential Splice Site 663 2144 8 33
Genomic Location (Zv9):
Chromosome 15 (position 13349442)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12181375
KASP Assay ID:
554-3864.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCCAACCCCAGCTCTCCATCAGCCAGACTGTCTATGTCACAGTKAAAG[G/A]TTGGTGCTTACTGCTTATCATTTARGGAATGTTTAAGTCCTTGCAAAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 996 2144 14 33
Genomic Location (Zv9):
Chromosome 15 (position 13357944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGAGGTTTGACGGCAACAGCATAATCACCAGCTATGACATTGAGTA[C/A]AAGAACAAATCCGGTGCGCCATTGCTTTGTTTCCATTTCAAGCTTGGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 1552 2144 26 33
ENSDART00000079647 Nonsense 1552 2144 26 33
Genomic Location (Zv9):
Chromosome 15 (position 13388191)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12143412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAACACTATAAAATGTGGTGTTTTTTGTTTTTGTTTTTCAGAGCCA[C/T]AGTTCAATAAGGACCAGCCTCTCTTCACTCACATCAACTCCACTCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30989
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 1552 2144 26 33
ENSDART00000079647 Nonsense 1552 2144 26 33
Genomic Location (Zv9):
Chromosome 15 (position 13388191)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12143412
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGAACACTATAAAATGTGGTGTTTTTTGTTTTTGTTTTTCAGAGCCA[C/T]AGTTCAATAAGGACCAGCCTCTCTTCACTCACATCAACTCCACTCATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39037
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 1689 2144 27 33
Genomic Location (Zv9):
Chromosome 15 (position 13388966)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12142637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGTCACATTGGGTATGGCTCTGCTCTTTATTATCCGCAAGAAACGC[A/T]AGGAAAAAAGACTCAAGAGACTCAGAGGTGAGAGCAAAAGAGGCAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Essential Splice Site 1698 2144 28 33
Genomic Location (Zv9):
Chromosome 15 (position 13389176)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12142427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACAGTTTTTTTTTTTTTTTTTTTATGAAATGCTTCTTATTTCCCATGC[A/G]GATGCGAAGAGCTTGGCTGAGATGCTTATCAGGTAAGGATATAGTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 1897 2144 32 33
Genomic Location (Zv9):
Chromosome 15 (position 13390438)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12141165
KASP Assay ID:
2260-8194.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGAGTTGGCCAGAGCATACGAACATGCTAAGCTGGAGGAGCACCTA[C/T]AACATGCCAAGTTTGAGATTACAGAGTGCTTCATCTCCGATAGCTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Essential Splice Site 1967 2144 32 33
Genomic Location (Zv9):
Chromosome 15 (position 13390652)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12140951
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACCGTGGCAAAAACGTGGCAGTGCCCATACCCCATCGAGCCAACAAGA[G/A]TGAGTTGATGATGTATTCAGGTGCTTTTAGAGGAGCACTCCACTTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079647 Nonsense 2100 2144 33 33
Genomic Location (Zv9):
Chromosome 15 (position 13391846)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 12139757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAAGTGGGGCAGTTGCCGCTGGAGCAGGAGCGAGTGCAAGCTCCACA[G/T]GAGGCAGCGGCCCGACGCCCGGGAGCTCCAAGGTTGGAGGATCCAGAGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Triglycerides: A null mutation in human APOC3 confers a favorable plasma lipid profile and apparent cardioprotection. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link