NP_001177236.1

Ensembl ID:
ENSDARG00000057049
Description:
potassium channel, subfamily K, member 18 [Source:RefSeq peptide;Acc:NP_001177236]
Human Orthologue:
KCNK18
Human Description:
potassium channel, subfamily K, member 18 [Source:HGNC Symbol;Acc:19439]
Mouse Orthologue:
Kcnk18
Mouse Description:
potassium channel, subfamily K, member 18 Gene [Source:MGI Symbol;Acc:MGI:2685627]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10771 Nonsense Available for shipment Available now
sa6474 Nonsense Mutation detected in F1 DNA During 2017
sa8409 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10771
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 120 391 3 3
ENSDART00000079646 Nonsense 120 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608333)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758482
KASP Assay ID:
554-4184.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATTTGTWACTCTGTTCTGTTTTGTTTTTTTGTATATCAGGTTATGGA[C/T]GAATTTATCCGTTGACAAGTAAAGGGAAAGTGGCATGTGTCCTGTATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6474
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 120 391 3 3
ENSDART00000079646 Nonsense 120 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608333)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758482
KASP Assay ID:
554-4184.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATTTGTWACTCTGTTCTGTTTTGTTTTTTTGTATATCAGGTTATGGA[C/T]GAATTTATCCGTTGACAAGTAAAGGGAAAGTGGCATGTGTCCTGTATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079646 Nonsense 162 391 3 3
Genomic Location (Zv9):
Chromosome 17 (position 23608461)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23758610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCATCTCGGATGTGGGYGATCTCTTAGCTGTTCTCCTCTCCAAAGCATA[T/G]ACTCGCCTTAACCTGTTCTTCAGAMGAKGGATAGGACATCAGTCATGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link