si:ch211-191j22.5

Ensembl ID:
ENSDARG00000057037
ZFIN ID:
ZDB-GENE-091118-74
Human Orthologue:
KCNK13
Human Description:
potassium channel, subfamily K, member 13 [Source:HGNC Symbol;Acc:6275]
Mouse Orthologue:
Kcnk13
Mouse Description:
potassium channel, subfamily K, member 13 Gene [Source:MGI Symbol;Acc:MGI:2384976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43629 Nonsense Mutation detected in F1 DNA During 2017
sa23917 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079634 Nonsense 180 397 2 4
ENSDART00000146102 Nonsense 190 422 2 3
Genomic Location (Zv9):
Chromosome 21 (position 20188374)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21323863
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGTGGGAGGAGAGGAGGCCAGAAGTGAGGACGACAGTCTGGAGGGCTGG[A/T]AACCTTCAGTCTACTACGTGATGCTCATTCTGGGCATCGCTGCCCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23917
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079634 Nonsense 241 397 2 4
ENSDART00000146102 Nonsense 251 422 2 3
Genomic Location (Zv9):
Chromosome 21 (position 20188557)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21324046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGCACTATTGGATTTGGGGATGTGGTGAGCAGCCAGCGGGAAAACTAT[A/T]AAGCTCAGGAGGCCTACCGTTTCGGCAACTGCCTCTTCATCCTGATGGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link