htr2a

Ensembl ID:
ENSDARG00000057029
ZFIN ID:
ZDB-GENE-070912-500
Description:
Novel protein similar to vertebrate 5-hydroxytryptamine (Serotonin) receptor 2A (HTR2A) [Source:UniP
Human Orthologue:
HTR2A
Human Description:
5-hydroxytryptamine (serotonin) receptor 2A [Source:HGNC Symbol;Acc:5293]
Mouse Orthologue:
Htr2a
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 2A Gene [Source:MGI Symbol;Acc:MGI:109521]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21494 Nonsense Available for shipment Available now
sa9359 Nonsense Mutation detected in F1 DNA During 2014
sa18946 Nonsense Mutation detected in F1 DNA During 2014
sa2517 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa21494
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079621 Nonsense 25 357 1 2
ENSDART00000141502 Nonsense 70 402 2 3
Genomic Location:
Chromosome 9 (position 26244111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTCATTCAATCTGATTCTCTGCATGTGTATCTCCTCTTCAGGTTACT[C/A]ATGGCCTTTCCCTGCATCACTGTGTCCCATGTGGATCTACCTAGATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9359
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079621 Nonsense 31 357 1 2
ENSDART00000141502 Nonsense 76 402 2 3
ENSDART00000079621 Nonsense 31 357 1 2
ENSDART00000141502 Nonsense 76 402 2 3
Genomic Location:
Chromosome 9 (position 26244093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCTGCATGTGTATCTCCTCTTCAGGTTACTCATGGCCTTTCCCWGCAT[C/A]ACTGTGTCCCATGTGGATCTACCTAGATGTGCTCTTCTCCACYGCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18946
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079621 Nonsense 31 357 1 2
ENSDART00000141502 Nonsense 76 402 2 3
ENSDART00000079621 Nonsense 31 357 1 2
ENSDART00000141502 Nonsense 76 402 2 3
Genomic Location:
Chromosome 9 (position 26244093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTGCATGTGTATCTCCTCTTCAGGTTACTCATGGCCTTTCCCTGCAT[C/A]ACTGTGTCCCATGTGGATCTACCTAGATGTGCTCTTCTCCACCGCCTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2517
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079621 Nonsense 234 357 2 2
ENSDART00000141502 Nonsense 279 402 3 3
ENSDART00000079621 Nonsense 234 357 2 2
ENSDART00000141502 Nonsense 279 402 3 3
Genomic Location:
Chromosome 9 (position 26231967)
KASP Assay ID:
554-3255.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGCCTCTAAAGTTCTGGGGGTAGTTTTCTTTCTCTTTGTGGTCATGT[G/A]GTGCCCCTTTTTTATMACCAATGTTTTGGCAGTGGTTTGTGAACCRAATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac hypertrophy: Hypertrophy-associated polymorphisms ascertained in a founder cohort applied to heart failure risk and mortality. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xg2ll1a0