chrna2b

Ensembl ID:
ENSDARG00000057025
ZFIN ID:
ZDB-GENE-041001-99
Description:
Novel cholinergic receptor, nicotinic, alpha polypeptide protein [Source:UniProtKB/TrEMBL;Acc:Q5RHN0
Human Orthologue:
CHRNA2
Human Description:
cholinergic receptor, nicotinic, alpha 2 (neuronal) [Source:HGNC Symbol;Acc:1956]
Mouse Orthologue:
Chrna2
Mouse Description:
cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) Gene [Source:MGI Symbol;Acc:MGI:8788

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23670 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23670
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079613 Nonsense 197 556 6 7
ENSDART00000136317 Nonsense 168 527 4 5
Genomic Location:
Chromosome 20 (position 19893885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGAAATTCGGCTCGTGGACTTACGACAAAGCCAAGATTGACCTAGAG[C/T]GAATCGAGAACACAGTGGACTTGAAAGATTACTGGGAGAGTGGAGAGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8s5i8kk1