cdc14ab

Ensembl ID:
ENSDARG00000057016
ZFIN ID:
ZDB-GENE-070705-309
Description:
dual specificity protein phosphatase CDC14A [Source:RefSeq peptide;Acc:NP_001122010]
Human Orthologue:
CDC14A
Human Description:
CDC14 cell division cycle 14 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:1718]
Mouse Orthologue:
Cdc14a
Mouse Description:
CDC14 cell division cycle 14 homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2442676]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3207 Nonsense Mutation detected in F1 DNA During 2014
sa24125 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19284 Nonsense Mutation detected in F1 DNA During 2014
sa11954 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105681 Nonsense 142 510 5 15
ENSDART00000105681 Nonsense 142 510 5 15
Genomic Location:
Chromosome 22 (position 16456482)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCAGAAGAAGCCTACAGAGCCCTRATCTCCGGCTCCAATGCCTCCTA[T/A]CTTCCTTTCAGGTACGACTTATCCACATCATCTGCAGTGTTTGCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105681 Essential Splice Site 168 510 6 15
Genomic Location:
Chromosome 22 (position 16447072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCACATACAACCTGACGGTTCTTGACTGTTTACAAGGCATTAGGAAGG[T/C]GAGATGTGCATTGTGATACTATACGTAGCCATATTTTTTCCCCTATTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19284
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105681 Nonsense 188 510 7 15
ENSDART00000105681 Nonsense 188 510 7 15
Genomic Location:
Chromosome 22 (position 16436734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGATTTTTGAACTTCGAGACTTTCGATGTTAACGAATATGAACATTA[T/G]GAGGTAATGATGCCCCTTTTCACCCCTTCGTTATGAAATGCGACTTGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105681 Nonsense 188 510 7 15
ENSDART00000105681 Nonsense 188 510 7 15
Genomic Location:
Chromosome 22 (position 16436734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGGAWTTTTGAACTTCGAGACTTTCGATGTTAACGAATATGAACATTA[T/G]GAGGTAATGATGCCCCTTTTCACCCCTTCGTTATGAAATGCGACTTGCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w4awednw