NP_001038711.1

Ensembl ID:
ENSDARG00000057013
Description:
cell adhesion molecule 3 [Source:RefSeq peptide;Acc:NP_001038711]
Human Orthologue:
CADM3
Human Description:
cell adhesion molecule 3 [Source:HGNC Symbol;Acc:17601]
Mouse Orthologue:
Cadm3
Mouse Description:
cell adhesion molecule 3 Gene [Source:MGI Symbol;Acc:MGI:2137858]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38354 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44546 Essential Splice Site Mutation detected in F1 DNA During 2017
sa33009 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596   None 373 None 8
ENSDART00000111246 Essential Splice Site None 393 None 11
ENSDART00000124222   None 413 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44244756)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44330257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCCTGAACCGACGGAGCCATCGGGCATCACGAGGAGCGCTTATATCGG[T/C]GAGTATCGTAATCTGCCCTCCTTTTGAGCTCACAGACACGCAGGGGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 Essential Splice Site 51 373 2 8
ENSDART00000111246 Essential Splice Site 64 393 4 11
ENSDART00000124222 Essential Splice Site 91 413 3 9
Genomic Location (Zv9):
Chromosome 2 (position 44155380)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACGGCACCTATGTAGTGTATGTGTTCCTCTTATCGGTTCTGTCTTTTTC[A/T]GCACTGAGAGATAACCGTATCCAGTTGGTAAAGTCCACGGCCACGGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079596 Essential Splice Site 335 373 7 8
ENSDART00000111246 Essential Splice Site 355 393 10 11
ENSDART00000124222 Essential Splice Site 375 413 8 9
Genomic Location (Zv9):
Chromosome 2 (position 44117885)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44203386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCTCTGTCTCCTCCTTGTCCTCGGCAGATACCTCATCAGACACAAAGG[T/C]AACACACACACACACATACAAGGCAAATCAGACAAAGAAATCTCTTACTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Inflammatory biomarkers: A genome-wide association scan on the levels of markers of inflammation in Sardinians reveals associations that underpin its complex regulation. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link