dpm1

Ensembl ID:
ENSDARG00000057011
ZFIN ID:
ZDB-GENE-040801-115
Description:
dolichol-phosphate mannosyltransferase [Source:RefSeq peptide;Acc:NP_001003596]
Human Orthologue:
DPM1
Human Description:
dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit [Source:HGNC Symbol;Acc:3005
Mouse Orthologue:
Dpm1
Mouse Description:
dolichol-phosphate (beta-D) mannosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:1330239]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30737 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30737
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079591 Essential Splice Site 89 250 None 9

The following transcripts of ENSDARG00000057011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20802202)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20587309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTATTCTTTTCAGCTCCTGAGACCGCGAGCAGAAAAGCTGGGATTAGG[T/C]AAACTGGCTCATTATGCTAAATAATCATTTTATTAATGCTTCTTAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079591 Nonsense 130 250 6 9

The following transcripts of ENSDARG00000057011 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 20803253)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 20588360
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACTTCCACAAATTTGATATTTGTTCAGAAAACAGAAAGAAGGTGGATA[T/G]GACCTGGTGTCTGGCACAAGGTACAGAGGAGATGGTGGTGTGTATGGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link