ctbp1

Ensembl ID:
ENSDARG00000057007
ZFIN ID:
ZDB-GENE-010130-1
Description:
C-terminal binding protein 1 [Source:RefSeq peptide;Acc:NP_571789]
Human Orthologue:
CTBP1
Human Description:
C-terminal binding protein 1 [Source:HGNC Symbol;Acc:2494]
Mouse Orthologue:
Ctbp1
Mouse Description:
C-terminal binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201685]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19082 Essential Splice Site Mutation detected in F1 DNA During 2014
sa197 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079583 Essential Splice Site None 449 2 11
ENSDART00000122739 None None 449 None 9
ENSDART00000144367 None None 288 None 6
Genomic Location:
Chromosome 14 (position 22824514)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGACTGTGACGTCAGCAGAGTGGTTGATTGGCTTTGACATCATCAAG[T/C]AGGTGGTTGCATTATTATTATTATTATTATTATTATTTTCAGTCATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079583 Nonsense 60 449 4 11
ENSDART00000122739 Nonsense 60 449 2 9
ENSDART00000144367 Nonsense 44 288 2 6
Genomic Location:
Chromosome 14 (position 22837679)
KASP Assay ID:
554-0109.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAGTGGAGATGCCCATCCTGAAGGACGTGGCCACTGTGGCTTTCTG[C/A]GATGCCCAGTCCACCCAGGAGATCCATGAGAAGGTATCGTCATAAGGATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wojchpyg