ctbp1

Ensembl ID:
ENSDARG00000057007
ZFIN ID:
ZDB-GENE-010130-1
Description:
C-terminal binding protein 1 [Source:RefSeq peptide;Acc:NP_571789]
Human Orthologue:
CTBP1
Human Description:
C-terminal binding protein 1 [Source:HGNC Symbol;Acc:2494]
Mouse Orthologue:
Ctbp1
Mouse Description:
C-terminal binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1201685]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19082 Essential Splice Site Mutation detected in F1 DNA During 2016
sa197 Nonsense Available for shipment Available now
sa35683 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa19082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079583 Essential Splice Site None 449 2 11
ENSDART00000122739   None 449 None 9
ENSDART00000144367   None 288 None 6
Genomic Location (Zv9):
Chromosome 14 (position 22824514)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21524002
KASP Assay ID:
2261-7170.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGACTGTGACGTCAGCAGAGTGGTTGATTGGCTTTGACATCATCAAG[T/C]AGGTGGTTGCATTATTATTATTATTATTATTATTATTTTCAGTCATCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa197
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079583 Nonsense 60 449 4 11
ENSDART00000122739 Nonsense 60 449 2 9
ENSDART00000144367 Nonsense 44 288 2 6
Genomic Location (Zv9):
Chromosome 14 (position 22837679)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21537167
KASP Assay ID:
554-0109.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACAGTGGAGATGCCCATCCTGAAGGACGTGGCCACTGTGGCTTTCTG[C/A]GATGCCCAGTCCACCCAGGAGATCCATGAGAAGGTATCGTCATAAGGATT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa35683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079583 Nonsense 179 449 6 11
ENSDART00000122739 Nonsense 179 449 4 9
ENSDART00000144367 Nonsense 163 288 4 6
Genomic Location (Zv9):
Chromosome 14 (position 22838192)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 21537680
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCCAGCGTGGAGCAGATCCGGGAAGTAGCCGGAGGCGCAGCACGTATT[C/T]GAGGAGAAACGCTGGGCATCATTGGGCTGGGTGAGTCCTGATGTGATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link