Q1RLR4_DANRE

Ensembl ID:
ENSDARG00000057004
Description:
LOC563523 protein [Source:UniProtKB/TrEMBL;Acc:Q1RLR4]
Human Orthologue:
FGL1
Human Description:
fibrinogen-like 1 [Source:HGNC Symbol;Acc:3695]
Mouse Orthologue:
Fgl1
Mouse Description:
fibrinogen-like protein 1 Gene [Source:MGI Symbol;Acc:MGI:102795]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27608 Essential Splice Site Mutation detected in F1 DNA During 2017
sa9778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa27608
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079566 Essential Splice Site 222 345 7 8
Genomic Location (Zv9):
Chromosome 10 (position 25119374)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24718726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGTTCATATGGATGAAGTCTCAATTACATTCCTCTCTGCTCACTAT[A/G]GGATAAATACAGGCTGTACTATGGGATGTACAGTGGTCAAGCAGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079566 Nonsense 314 345 8 8
Genomic Location (Zv9):
Chromosome 10 (position 25118468)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 24717820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTGGAGAGTACAAGGCCAAATATGACAATGGTATTGTTTGGAGCACCT[G/A]GAAAGGACTGTGGTACTCYCTCAGACACACWGTCATGAAGGTCCGGCCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link