camkvl

Ensembl ID:
ENSDARG00000057000
ZFIN ID:
ZDB-GENE-090311-58
Description:
Adnp protein [Source:UniProtKB/TrEMBL;Acc:Q503X1]
Human Orthologue:
CAMKV
Human Description:
CaM kinase-like vesicle-associated [Source:HGNC Symbol;Acc:28788]
Mouse Orthologue:
Camkv
Mouse Description:
CaM kinase-like vesicle-associated Gene [Source:MGI Symbol;Acc:MGI:2384296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17380 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079586 Nonsense 221 753 7 10
ENSDART00000146008 Nonsense 221 753 8 11
Genomic Location:
Chromosome 23 (position 20919504)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATTTAATGCAAATKATAWTTGTAGGTTGTCTGGAAACCCTCCATTTTA[T/A]GATGAAACTGAGGAGGAAAACACTGACATGCACAACCGGATCATCTTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y3o10hxq