kirrelb

Ensembl ID:
ENSDARG00000056998
ZFIN ID:
ZDB-GENE-070912-173
Description:
kin of IRRE like b [Source:RefSeq peptide;Acc:NP_001124123]
Human Orthologue:
KIRREL
Human Description:
kin of IRRE like (Drosophila) [Source:HGNC Symbol;Acc:15734]
Mouse Orthologue:
Kirrel
Mouse Description:
kin of IRRE like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891396]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15122 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079582 Essential Splice Site 174 790 4 15
ENSDART00000146804 Essential Splice Site 174 778 4 15
Genomic Location:
Chromosome 2 (position 44049775)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGGTACAAAGATGGGATCATAGTGGAAGGAGCTCATACCAGCACTG[T/C]GAGTGACGACACAAGGGGATGTGACAAAGCAAACAAATATACAGTTGAAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xo90ak13