kirrelb

Ensembl ID:
ENSDARG00000056998
ZFIN ID:
ZDB-GENE-070912-173
Description:
kin of IRRE like b [Source:RefSeq peptide;Acc:NP_001124123]
Human Orthologue:
KIRREL
Human Description:
kin of IRRE like (Drosophila) [Source:HGNC Symbol;Acc:15734]
Mouse Orthologue:
Kirrel
Mouse Description:
kin of IRRE like (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1891396]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15122 Essential Splice Site Available for shipment Available now
sa25893 Essential Splice Site Mutation detected in F1 DNA During 2016
sa33008 Nonsense Mutation detected in F1 DNA During 2016
sa39923 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15122
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079582 Essential Splice Site 174 790 4 15
ENSDART00000146804 Essential Splice Site 174 778 4 15
Genomic Location (Zv9):
Chromosome 2 (position 44049775)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44135276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAATGGTACAAAGATGGGATCATAGTGGAAGGAGCTCATACCAGCACTG[T/C]GAGTGACGACACAAGGGGATGTGACAAAGCAAACAAATATACAGTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079582 Essential Splice Site 225 790 5 15
ENSDART00000146804 Essential Splice Site 225 778 5 15
Genomic Location (Zv9):
Chromosome 2 (position 44048695)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44134196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCTGCTCCACTGGGGAAGAGATCAACTGTCACCCTCAACATCCACCG[T/A]AAGTGTGTGCAGTTTAATAGTCGACTTTAGATATTATTCTAACTATAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33008
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079582 Nonsense 531 790 12 15
ENSDART00000146804 Nonsense 531 778 12 15
Genomic Location (Zv9):
Chromosome 2 (position 44034567)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44120068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTCCATTTTGCTTCTGCTTCTCCTCTTTGCTCTGATTTTCTATCTGTA[T/A]CGACAACGCAAAAGCAGTGAGTACACGGTTTATGTGTGAGTGTATCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079582 Nonsense 729 790 15 15
ENSDART00000146804 Nonsense 717 778 15 15
Genomic Location (Zv9):
Chromosome 2 (position 44024694)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44110195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATCCACTAGCTTTTGACAGCTACGCCTACTCAACCACACCTCAATA[C/A]CGGTTAGGCTTTGCTCCGCCTTTGGAGGCGGGACCAGCCTATGAAATGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link