dact2

Ensembl ID:
ENSDARG00000056986
ZFIN ID:
ZDB-GENE-030131-9975
Description:
Dapper homolog 2 [Source:UniProtKB/Swiss-Prot;Acc:Q673G8]
Human Orthologue:
DACT2
Human Description:
dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis) [Source:HGNC Symbol;Acc:21231]
Mouse Orthologue:
Dact2
Mouse Description:
dapper homolog 2, antagonist of beta-catenin (xenopus) Gene [Source:MGI Symbol;Acc:MGI:1920347]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000084321 Nonsense 553 837 4 4
Genomic Location (Zv9):
Chromosome 13 (position 44034968)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 43272083
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCCTCAGCAAAGAAACAGCATCAAAAACCCTTGTCTCGAGAGTTCTG[C/A]ACCAAAAACAGAACTGACTTGAAGCAGTCCGGCTCATGCAGAGGGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link