rad9a

Ensembl ID:
ENSDARG00000056984
ZFIN ID:
ZDB-GENE-040426-935
Description:
hypothetical protein LOC393176 [Source:RefSeq peptide;Acc:NP_956501]
Human Orthologue:
RAD9A
Human Description:
RAD9 homolog A (S. pombe) [Source:HGNC Symbol;Acc:9827]
Mouse Orthologue:
Rad9
Mouse Description:
RAD9 homolog (S. pombe) Gene [Source:MGI Symbol;Acc:MGI:1328356]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15787 Essential Splice Site Available for shipment Available now
sa13610 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054420 Essential Splice Site 35 381 None 11

The following transcripts of ENSDARG00000056984 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 22934840)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCGAGAATTGGAGAGGAGCTGTATTTGGAGCCTGTGGATGATGGGG[T/A]AACATCAYTAATKTTTCAGTTGTGTTTTTATTWAGYCAGATGTGAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054420 Nonsense 195 381 7 11

The following transcripts of ENSDARG00000056984 do not overlap with this mutation:

Genomic Location:
Chromosome 14 (position 22931732)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNTTTTTTTCTTTCAGACTCATCACGAGCAATGAWGACTGAATTATGTT[T/A]GAGCTCAGAGGAGTTTGATCATTTTGCCATCRGCTCTCAGACCAGCATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3e2ayzfc