lhx9

Ensembl ID:
ENSDARG00000056979
ZFIN ID:
ZDB-GENE-050417-210
Description:
LIM/homeobox protein Lhx9 [Source:UniProtKB/Swiss-Prot;Acc:Q1LWV4]
Human Orthologue:
LHX9
Human Description:
LIM homeobox 9 [Source:HGNC Symbol;Acc:14222]
Mouse Orthologue:
Lhx9
Mouse Description:
LIM homeobox protein 9 Gene [Source:MGI Symbol;Acc:MGI:1316721]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14260 Essential Splice Site Available for shipment Available now
sa37520 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3161 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa14260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054807 Essential Splice Site 126 396 3 5
ENSDART00000079556 Essential Splice Site 126 330 3 5
Genomic Location (Zv9):
Chromosome 22 (position 24978116)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23236845
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGTTTTCATCNNNNTATGTTTGATTGTAAATGGTGTGTGCTGTTCC[A/T]GAAGGTTCTCCGTGCAGAGATGTGCCCGCTGCCACCTCGGCATATCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054807 Essential Splice Site 312 396 4 5
ENSDART00000079556 Essential Splice Site 312 330 4 5
Genomic Location (Zv9):
Chromosome 22 (position 24974474)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23233203
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTAAAACAACTCGCCCAAAAGACAGGACTGACCAAGAGAGTTCTTCAG[G/A]TAAGAGTCGCCACACAGTAGACTCCATTTCACATCCAAACCGACACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3161
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054807   None 396 None 5
ENSDART00000079556 Nonsense 315 330 5 5
Genomic Location (Zv9):
Chromosome 22 (position 24970146)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23228875
KASP Assay ID:
554-2646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTGTAGTTTAATATATTGTTACTTTATGATTTTTTTTCAGGGAGAA[C/T]AAATCTTGGGGCATTACAGCCATACTTCACGACGTTTGAAAATTCCCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link