lhx9

Ensembl ID:
ENSDARG00000056979
ZFIN ID:
ZDB-GENE-050417-210
Description:
LIM/homeobox protein Lhx9 [Source:UniProtKB/Swiss-Prot;Acc:Q1LWV4]
Human Orthologue:
LHX9
Human Description:
LIM homeobox 9 [Source:HGNC Symbol;Acc:14222]
Mouse Orthologue:
Lhx9
Mouse Description:
LIM homeobox protein 9 Gene [Source:MGI Symbol;Acc:MGI:1316721]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14260 Essential Splice Site Available for shipment Available now
sa3161 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14260
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054807 Essential Splice Site 126 396 3 5
ENSDART00000079556 Essential Splice Site 126 330 3 5
Genomic Location:
Chromosome 22 (position 24978116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATGTTTTCATCNNNNTATGTTTGATTGTAAATGGTGTGTGCTGTTCC[A/T]GAAGGTTCTCCGTGCAGAGATGTGCCCGCTGCCACCTCGGCATATCCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3161
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054807 None None 396 None 5
ENSDART00000079556 Nonsense 315 330 5 5
Genomic Location:
Chromosome 22 (position 24970146)
KASP Assay ID:
554-2646.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCTGTAGTTTAATATATTGTTACTTTATGATTTTTTTTCAGGGAGAA[C/T]AAATCTTGGGGCATTACAGCCATACTTCACGACGTTTGAAAATTCCCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vuzjxmn0