letm1

Ensembl ID:
ENSDARG00000056978
ZFIN ID:
ZDB-GENE-050522-154
Description:
LETM1 and EF-hand domain-containing protein 1, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q1LY46
Human Orthologue:
LETM1
Human Description:
leucine zipper-EF-hand containing transmembrane protein 1 [Source:HGNC Symbol;Acc:6556]
Mouse Orthologue:
Letm1
Mouse Description:
leucine zipper-EF-hand containing transmembrane protein 1 Gene [Source:MGI Symbol;Acc:MGI:1932557]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18160 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18160
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079558 Essential Splice Site 26 757 1 14

The following transcripts of ENSDARG00000056978 do not overlap with this mutation:

Genomic Location:
Chromosome 13 (position 12903292)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTCCGTTGTTGAAAACATCCAGGTCATTAAAGAACGAATTCAGAAAAG[G/A]TAATACTGCCTTTTAAATGTTAAAGGGGGTAGATAAGTGTSTGGRTTATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/wvvawyqy