nek7

Ensembl ID:
ENSDARG00000056966
ZFIN ID:
ZDB-GENE-040801-136
Description:
serine/threonine-protein kinase Nek7 [Source:RefSeq peptide;Acc:NP_001003617]
Human Orthologues:
NEK6, NEK7
Human Descriptions:
NIMA (never in mitosis gene a)-related kinase 6 [Source:HGNC Symbol;Acc:7749]
NIMA (never in mitosis gene a)-related kinase 7 [Source:HGNC Symbol;Acc:13386]
Mouse Orthologues:
Nek6, Nek7
Mouse Descriptions:
NIMA (never in mitosis gene a)-related expressed kinase 6 Gene [Source:MGI Symbol;Acc:MGI:1891638]
NIMA (never in mitosis gene a)-related expressed kinase 7 Gene [Source:MGI Symbol;Acc:MGI:1890645]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24175 Nonsense Available for shipment Available now
sa13206 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24175
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079536 Nonsense 58 297 3 10
Genomic Location (Zv9):
Chromosome 22 (position 24904223)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23162952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGAAGTTTATCGAGCTACGTACGTTCTAGACCACACTATAGTTGCTT[T/A]GAAGAAAATACAGGTAAGAAATTCATCCCATAATGTCATTCAGCAAGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13206
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079536 Nonsense 283 297 10 10
Genomic Location (Zv9):
Chromosome 22 (position 24833075)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 23091804
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAGATATGTGCATCAACCCGGACCCGGAGAAAAGGCCCGACATCACCTR[T/A]GTGTACAGCATGGCCAAACACATGCACGGTCGGATCGCAAACTGAGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link