CCDC30 (1 of 2)

Ensembl ID:
ENSDARG00000056961
Description:
coiled-coil domain containing 30 [Source:HGNC Symbol;Acc:26103]
Human Orthologue:
CCDC30
Human Description:
coiled-coil domain containing 30 [Source:HGNC Symbol;Acc:26103]
Mouse Orthologue:
Ccdc30
Mouse Description:
coiled-coil domain containing 30 Gene [Source:MGI Symbol;Acc:MGI:1920582]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4229 Nonsense Mutation detected in F1 DNA During 2014
sa11688 Nonsense Available for shipment Available now
sa24305 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa4229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Nonsense 739 1207 18 27
Genomic Location:
Chromosome 23 (position 21009439)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTAAAACAGGAYCTGCAGAGAACCCAGCACCTCTTCACCTCGGCTGAG[C/T]GAGAGCTACGCTACGAGAGAGAGAAAAATCTTGACCTTAAGAGACACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Nonsense 771 1207 19 27
Genomic Location:
Chromosome 23 (position 21010171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAACATCATGTTTATGCTTSGTTTTCTTTAGCTGTGTGCAGAGCTGAAG[C/T]AGGCCCAGGCCAAAGTAGCCCAGCATGAGGGGARCGCAGCAGGACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079538 Essential Splice Site 983 1207 22 27
Genomic Location:
Chromosome 23 (position 21013697)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGGAAGAGCTGAAGCTGGTCGTCCAGCAGCTTGACACAAATGTCAGG[T/C]ATTATTCCTCAATGGCTGAAAATGACAGTAGAGTTTGGCGTAGGTTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lar5enfs