LOC556202

Ensembl ID:
ENSDARG00000056957
Human Orthologue:
GABRG1
Human Description:
gamma-aminobutyric acid (GABA) A receptor, gamma 1 [Source:HGNC Symbol;Acc:4086]
Mouse Orthologue:
Gabrg1
Mouse Description:
gamma-aminobutyric acid (GABA) A receptor, subunit gamma 1 Gene [Source:MGI Symbol;Acc:MGI:103156]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28076 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28076
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079535 Essential Splice Site 211 475 7 11
Genomic Location (Zv9):
Chromosome 13 (position 12057235)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 12055603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAACTGAAAGGTCACATGTAATGTGGTGGATGTGTTTTTTTCCGTTTGC[A/T]GATGGGTATCCAAAGAATGAGATCCAGTATAGATGGCAGCGTCGTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link