LOC562111

Ensembl ID:
ENSDARG00000056949
Human Orthologue:
HTR7
Human Description:
5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) [Source:HGNC Symbol;Acc:5302]
Mouse Orthologue:
Htr7
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 7 Gene [Source:MGI Symbol;Acc:MGI:99841]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12427 Nonsense Available for shipment Available now
sa13434 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079534 Nonsense 244 479 2 2
Genomic Location:
Chromosome 17 (position 23373152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTGTGGTTGCTCTCTGCGTCAATCACGCTKCCACCTCTCTTCGGCTG[G/A]GCACAGAACGTCAACGATGACCGTGTGTGTCTGMTCAGCCAGGACTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079534 Nonsense 444 479 2 2
Genomic Location:
Chromosome 17 (position 23372554)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAATCCYTTCATCTACGCTTTCTTYAACCGTGACCTGAGAACTACCTAC[C/T]GAAGCCTCCTCAGCTGCAGATACCRCAATATTAACCGCAGACTGTCAGCY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u97emu3c