or125-8

Ensembl ID:
ENSDARG00000056940
ZFIN ID:
ZDB-GENE-070806-98
Description:
odorant receptor, family E, subfamily 125, member 8 [Source:RefSeq peptide;Acc:NP_001121878]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23918 Nonsense Available for shipment Available now
sa43632 Nonsense Mutation detected in F1 DNA During 2016
sa3117 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa23918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079524 Nonsense 19 341 1 1
Genomic Location (Zv9):
Chromosome 21 (position 20543157)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21619327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACAGGTCATATCCTGTCATACTGACCCTCATGGTGCCAAAAGATTCT[A/T]AGTCATACAGACATGTTTATTTTACTTGTTTTCTTCTTCTTTACCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079524 Nonsense 37 341 1 1
Genomic Location (Zv9):
Chromosome 21 (position 20543212)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21619382
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGACATGTTTATTTTACTTGTTTTCTTCTTCTTTACCTGCTGATAT[T/A]GTCAATTAATATTCGTCTTGTTATGGTCATTATCATGGAGAAAGCTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3117
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079524 Nonsense 65 341 1 1
Genomic Location (Zv9):
Chromosome 21 (position 20543297)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21619467
KASP Assay ID:
554-2784.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGAAAGCTCTTCATGGACCAATGTACATCTTCTTATGTCATCTGTG[T/A]GTAAATGGTGTTTATGGAGCAACAGGATTTTACCCTAAATTTCTGTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link