or125-8

Ensembl ID:
ENSDARG00000056940
ZFIN ID:
ZDB-GENE-070806-98
Description:
odorant receptor, family E, subfamily 125, member 8 [Source:RefSeq peptide;Acc:NP_001121878]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23918 Nonsense Available for shipment Available now
sa3117 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa23918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079524 Nonsense 19 341 1 1
Genomic Location:
Chromosome 21 (position 20543157)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACAGGTCATATCCTGTCATACTGACCCTCATGGTGCCAAAAGATTCT[A/T]AGTCATACAGACATGTTTATTTTACTTGTTTTCTTCTTCTTTACCTGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3117
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079524 Nonsense 65 341 1 1
Genomic Location:
Chromosome 21 (position 20543297)
KASP Assay ID:
554-2784.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGAAAGCTCTTCATGGACCAATGTACATCTTCTTATGTCATCTGTG[T/A]GTAAATGGTGTTTATGGAGCAACAGGATTTTACCCTAAATTTCTGTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b19au3fk