hepacam

Ensembl ID:
ENSDARG00000056934
ZFIN ID:
ZDB-GENE-050522-198
Description:
hepatocyte cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001018526]
Human Orthologue:
HEPACAM
Human Description:
hepatocyte cell adhesion molecule [Source:HGNC Symbol;Acc:26361]
Mouse Orthologue:
Hepacam
Mouse Description:
hepatocyte cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1920177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24982 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24982
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079510 Essential Splice Site 143 422 3 7
Genomic Location (Zv9):
Chromosome 15 (position 21281307)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22383933
KASP Assay ID:
554-7546.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAAAACTGCTACTGACTTTCTTTGTCTATGTCATGCTGTTTTTTCA[G/A]TTCCAGTGTCCAGACCATTTATACACATGGTGGCCTCGTCTGTCCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link