
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tfip11
- Ensembl ID:
- ENSDARG00000056932
- ZFIN ID:
- ZDB-GENE-040718-479
- Description:
- Tuftelin-interacting protein 11 [Source:UniProtKB/Swiss-Prot;Acc:Q6DI35]
- Human Orthologue:
- TFIP11
- Human Description:
- tuftelin interacting protein 11 [Source:HGNC Symbol;Acc:17165]
- Mouse Orthologue:
- Tfip11
- Mouse Description:
- tuftelin interacting protein 11 Gene [Source:MGI Symbol;Acc:MGI:1930075]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17454 | Nonsense | Available for shipment | Available now |
sa3219 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa17454
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079506 | Nonsense | 112 | 832 | 3 | 14 |
- Genomic Location (Zv9):
- Chromosome 23 (position 18029367)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 17932306 GRCz11 23 17858649 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGCGGGAGGGTTCAGATGATTCTGATGCTGAAGAGGCACCTCCTCCACCC[C/T]GAGCTGCTGCTCCCAAAAAGCTCCAAACGGTAGATTGAGATGTRTGCAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa3219
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000079506 | Nonsense | 416 | 832 | 8 | 14 |
- Genomic Location (Zv9):
- Chromosome 23 (position 18025966)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 17928905 GRCz11 23 17855248 - KASP Assay ID:
- 554-2738.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCTGCAGACTGAGTTCTACCAGGAGTATAAGACTATGGGTTTGGGAGATT[T/A]AGCTGTGTCTGTTGTGCATCCTCTGTTGAAAGAAAAACTTCGCAATTGGG
- Associated Phenotype:
-
This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.
Stage Entity Quality Tag Hatching:Long-pec
ZFS:0000033central nervous system
ZFA:0000012necrotic
PATO:0000647abnormal
PATO:0000460Hatching:Long-pec
ZFS:0000033eye
ZFA:0000107decreased size
PATO:0000587abnormal
PATO:0000460Hatching:Long-pec
ZFS:0000033hindbrain
ZFA:0000029hydrocephalic
PATO:0001853abnormal
PATO:0000460Hatching:Long-pec
ZFS:0000033inner ear
ZFA:0000217decreased size
PATO:0000587abnormal
PATO:0000460Hatching:Long-pec
ZFS:0000033post-vent region
ZFA:0001117curved dorsal
PATO:0001468abnormal
PATO:0000460
- mRNA Expression Profiling Preview:
- View complete mRNA expression profile
Region | 3' end position | 3' end strand | Adjusted p-value | Log2 fold change (mutant/sibling) | Closest Ensembl gene 3' end | Gene name | e74 Ensembl Gene ID |
---|---|---|---|---|---|---|---|
17:15383322-15384300 | 15383322 | -1 | 5.64 × 10-67 | -7.8 | -6 | col10a1 | ENSDARG00000054753 |
12:2841701-2841913 | 2841913 | 1 | 4.27 × 10-49 | 6.8 | -1 | U3 | ENSDARG00000089524 |
20:7032101-7033441 | 7033441 | 1 | 2.44 × 10-47 | 4.4 | -1 | igfbp1a | ENSDARG00000014947 |
19:45245318-45245900 | 45245318 | -1 | 8.35 × 10-38 | -7.3 | 2 | matn1 | ENSDARG00000030215 |
11:6106523-6106700 | 6106523 | -1 | 4.33 × 10-37 | 4.5 | -1 | U6 | ENSDARG00000082005 |
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: