tfip11

Ensembl ID:
ENSDARG00000056932
ZFIN ID:
ZDB-GENE-040718-479
Description:
Tuftelin-interacting protein 11 [Source:UniProtKB/Swiss-Prot;Acc:Q6DI35]
Human Orthologue:
TFIP11
Human Description:
tuftelin interacting protein 11 [Source:HGNC Symbol;Acc:17165]
Mouse Orthologue:
Tfip11
Mouse Description:
tuftelin interacting protein 11 Gene [Source:MGI Symbol;Acc:MGI:1930075]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17454 Nonsense Available for shipment Available now
sa3219 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17454
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079506 Nonsense 112 832 3 14
Genomic Location:
Chromosome 23 (position 18029367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGGAGGGTTCAGATGATTCTGATGCTGAAGAGGCACCTCCTCCACCC[C/T]GAGCTGCTGCTCCCAAAAAGCTCCAAACGGTAGATTGAGATGTRTGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3219
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079506 Nonsense 416 832 8 14
Genomic Location:
Chromosome 23 (position 18025966)
KASP Assay ID:
554-2738.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCAGACTGAGTTCTACCAGGAGTATAAGACTATGGGTTTGGGAGATT[T/A]AGCTGTGTCTGTTGTGCATCCTCTGTTGAAAGAAAAACTTCGCAATTGGG
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

Control on top; Mutant below; 48 hpf

zoom

Stage Entity Quality Tag
Hatching:Long-pec
ZFS:0000033
central nervous system
ZFA:0000012
necrotic
PATO:0000647
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
eye
ZFA:0000107
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
hindbrain
ZFA:0000029
hydrocephalic
PATO:0001853
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
inner ear
ZFA:0000217
decreased size
PATO:0000587
abnormal
PATO:0000460
Hatching:Long-pec
ZFS:0000033
post-vent region
ZFA:0001117
curved dorsal
PATO:0001468
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
17:15383322-15384300 15383322 -1 5.64 × 10-67 -7.8 -6 col10a1 ENSDARG00000054753
12:2841701-2841913 2841913 1 4.27 × 10-49 6.8 -1 U3 ENSDARG00000089524
20:7032101-7033441 7033441 1 2.44 × 10-47 4.4 -1 igfbp1a ENSDARG00000014947
19:45245318-45245900 45245318 -1 8.35 × 10-38 -7.3 2 matn1 ENSDARG00000030215
11:6106523-6106700 6106523 -1 4.33 × 10-37 4.5 -1 U6 ENSDARG00000082005

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8cla6tdx