tfip11

Ensembl ID:: ENSDARG00000056932
ZFIN ID:: ZDB-GENE-040718-479
Description:: Tuftelin-interacting protein 11 [Source:UniProtKB/Swiss-Prot;Acc:Q6DI35]
Human Orthologue:: TFIP11
Human Description:: tuftelin interacting protein 11 [Source:HGNC Symbol;Acc:17165]
Mouse Orthologue:: Tfip11
Mouse Description:: tuftelin interacting protein 11 Gene [Source:MGI Symbol;Acc:MGI:1930075]

Alleles

There are 2 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa17454	Nonsense	Available for shipment	Available now
sa3219	Nonsense	Available for shipment	Available now

Mutation Details

Allele Name:: sa17454
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000079506	Nonsense	112	832	3	14

Genomic Location:: Chromosome 23 (position 18029367)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AGCGGGAGGGTTCAGATGATTCTGATGCTGAAGAGGCACCTCCTCCACCC[C/T]GAGCTGCTGCTCCCAAAAAGCTCCAAACGGTAGATTGAGATGTRTGCAAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa3219
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000079506	Nonsense	416	832	8	14

Genomic Location:

Chromosome 23 (position 18025966)

KASP Assay ID:

554-2738.1 (used for ordering genotyping assays from LGC Genomics)

KASP Sequence:

GCTGCAGACTGAGTTCTACCAGGAGTATAAGACTATGGGTTTGGGAGATT[T/A]AGCTGTGTCTGTTGTGCATCCTCTGTTGAAAGAAAAACTTCGCAATTGGG

Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on top; Mutant below; 48 hpf

zoom

Stage	Entity	Quality	Tag
Hatching:Long-pec ZFS:0000033	central nervous system ZFA:0000012	necrotic PATO:0000647	abnormal PATO:0000460
Hatching:Long-pec ZFS:0000033	eye ZFA:0000107	decreased size PATO:0000587	abnormal PATO:0000460
Hatching:Long-pec ZFS:0000033	hindbrain ZFA:0000029	hydrocephalic PATO:0001853	abnormal PATO:0000460
Hatching:Long-pec ZFS:0000033	inner ear ZFA:0000217	decreased size PATO:0000587	abnormal PATO:0000460
Hatching:Long-pec ZFS:0000033	post-vent region ZFA:0001117	curved dorsal PATO:0001468	abnormal PATO:0000460

Transcriptome Profiling Preview:: View complete transcriptome profile

Region	3' end position	3' end strand	Adjusted p-value	Log2 fold change (mutant/sibling)	Closest Ensembl gene 3' end	Gene name	e74 Ensembl Gene ID
17:15383322-15384300	15383322	-1	5.64 × 10^-67	-7.8	-6	col10a1	ENSDARG00000054753
12:2841701-2841913	2841913	1	4.27 × 10^-49	6.8	-1	U3	ENSDARG00000089524
20:7032101-7033441	7033441	1	2.44 × 10^-47	4.4	-1	igfbp1a	ENSDARG00000014947
19:45245318-45245900	45245318	-1	8.35 × 10^-38	-7.3	2	matn1	ENSDARG00000030215
11:6106523-6106700	6106523	-1	4.33 × 10^-37	4.5	-1	U6	ENSDARG00000082005

OMIM

OMIM information for TFIP11

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: