kdm6bb

Ensembl ID:
ENSDARG00000056929
ZFIN ID:
ZDB-GENE-040724-166
Description:
lysine (K)-specific demethylase 6B, b [Source:RefSeq peptide;Acc:NP_001025349]
Human Orthologue:
KDM6B
Human Description:
lysine (K)-specific demethylase 6B [Source:HGNC Symbol;Acc:29012]
Mouse Orthologue:
Kdm6b
Mouse Description:
KDM1 lysine (K)-specific demethylase 6B Gene [Source:MGI Symbol;Acc:MGI:2448492]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21723 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21724 Nonsense Mutation detected in F1 DNA During 2014
sa9809 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079505 Essential Splice Site 246 1719 5 19
ENSDART00000148334 None None 521 None 13

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 10 (position 22946275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGTCCTGGAGCCTGTCTGAGAAGAGGTCCTCCCCCTCCCGCTTTCAG[G/A]TTGGCCAGGGCTTTCAGTTGTGTTTTTAGTACAGTCGATTTTCTCTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21724
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079505 Nonsense 576 1719 7 19
ENSDART00000148334 None None 521 None 13
Genomic Location:
Chromosome 10 (position 22948611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAGTGAGACATCCATTTCAAAAACAGCATCTCCTAATTTGGGAACTT[T/A]GTATCCCAGTGATTCTGATCCTCTCTTGGATGACCTGCTGGCTGATCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9809
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079505 Splice Site, Nonsense 1416 1719 13 19
ENSDART00000148334 Splice Site, Nonsense 218 521 7 13
Genomic Location:
Chromosome 10 (position 22954441)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAGTTGTCCTGGTGTGAGTRAAGGACTGAGTGTGTTTGTCTTCAGGT[G/A]GAAGGCGCAGTTGCAGGAGCTGTTGAAGTTGCCTGCGTTCATGCGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bac9dagd