drd2a

Ensembl ID:
ENSDARG00000056926
ZFIN ID:
ZDB-GENE-021119-2
Description:
dopamine receptor D2a [Source:RefSeq peptide;Acc:NP_898891]
Human Orthologue:
DRD2
Human Description:
dopamine receptor D2 [Source:HGNC Symbol;Acc:3023]
Mouse Orthologue:
Drd2
Mouse Description:
dopamine receptor D2 Gene [Source:MGI Symbol;Acc:MGI:94924]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22636 Nonsense Available for shipment Available now
sa13590 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079507 Nonsense 200 448 4 7
Genomic Location (Zv9):
Chromosome 15 (position 21016652)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22119278
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTGCGAATCCTGCCTTTGTAGTTTACTCCTCCATTGTGTCCTTCTA[C/A]GTTCCCTTCATCATAACTCTGCTAGTGTACGTGCAGATCTACGTGGTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13590
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079507 Nonsense 346 448 6 7
Genomic Location (Zv9):
Chromosome 15 (position 21012637)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 22115263
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTRTCAAGCCTGAAAGAAATGGCAACACCAGCAGTATCACGAAAGGGGCC[A/T]AAGCATTTGAGATCCWGGTCTCCCCCACCGGCAAAACTCAGACATCAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link