sap130a

Ensembl ID:
ENSDARG00000056924
ZFIN ID:
ZDB-GENE-070615-5
Description:
histone deacetylase complex subunit SAP130 [Source:RefSeq peptide;Acc:NP_001092247]
Human Orthologue:
SAP130
Human Description:
Sin3A-associated protein, 130kDa [Source:HGNC Symbol;Acc:29813]
Mouse Orthologue:
Sap130
Mouse Description:
Sin3A associated protein Gene [Source:MGI Symbol;Acc:MGI:1919782]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33876 Nonsense Mutation detected in F1 DNA During 2017
sa33877 Nonsense Available for shipment Available now
sa9968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33876
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457   None 639 None 11
ENSDART00000088903 Nonsense 200 333 5 8
ENSDART00000123324 Nonsense 199 1072 5 21
Genomic Location (Zv9):
Chromosome 6 (position 27733331)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28034542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTGCTTCTTGTAGAAACGGTTTTGACAGGAATAATGTTTCTCCAGGGA[C/T]AGAGTAACCTGCATCAGCTAATGGCAACTAATGTGCAGATCTTCAGGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33877
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457   None 639 None 11
ENSDART00000088903   None 333 None 8
ENSDART00000123324 Nonsense 301 1072 7 21
Genomic Location (Zv9):
Chromosome 6 (position 27739649)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28040860
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACATCAACTGCTGTTCTACCCACAATGGTGGCGCCAATCCCAGCTGCT[C/T]GAACCCAGTCCCCGGTCATCAACACCACTGTCACACACGCTACAGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079457 Nonsense 430 639 7 11
ENSDART00000088903   None 333 None 8
ENSDART00000123324 Nonsense 863 1072 17 21
Genomic Location (Zv9):
Chromosome 6 (position 27749360)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 28050571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCTGGAGAGCTTCWGCCTGGTGCCTCTCCAAGGAAGAAACCYCGGAAA[C/T]AGCAGCATGTGATCTCCACTGAGGAGACKGAGATGGTGGAGACTAACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link