dbr1

Ensembl ID:
ENSDARG00000056923
ZFIN ID:
ZDB-GENE-030131-2466
Description:
Lariat debranching enzyme [Source:UniProtKB/Swiss-Prot;Acc:Q7T3E4]
Human Orthologue:
DBR1
Human Description:
debranching enzyme homolog 1 (S. cerevisiae) [Source:HGNC Symbol;Acc:15594]
Mouse Orthologue:
Dbr1
Mouse Description:
debranching enzyme homolog 1 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1931520]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41432 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41432
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079502 Essential Splice Site 108 568 2 8
Genomic Location (Zv9):
Chromosome 9 (position 28901184)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 28056880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAGCTTCCATATGGAGGCTGGGTGGCTCCTAACATCTATTATTTGGG[T/A]GAATCTTCAATAAATATTCAGGCAATGCAGTTAGATTAAATGGATTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link