LOC562072

Ensembl ID:
ENSDARG00000056922
Human Orthologue:
LTBP1
Human Description:
latent transforming growth factor beta binding protein 1 [Source:HGNC Symbol;Acc:6714]
Mouse Orthologue:
Ltbp1
Mouse Description:
latent transforming growth factor beta binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:109151]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36399 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23068 Nonsense Available for shipment Available now
sa7434 Missense Mutation detected in F1 DNA During 2016
sa23069 Nonsense Available for shipment Available now
sa23070 Essential Splice Site Available for shipment Available now
sa9759 Essential Splice Site Available for shipment Available now
sa23071 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36399
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 280 1384 7 35
Genomic Location (Zv9):
Chromosome 17 (position 22882457)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23032606
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGAACCAAGAAATATGAAAATGAGTCCCTGATATTTATTTTCACCCTC[A/C]GACATTGATGAATGTCAGCTTCAAGGTGTTTGTCCAAATGGAAACTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23068
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 342 1384 8 35
Genomic Location (Zv9):
Chromosome 17 (position 22887112)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23037261
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTCGCGAGGAGAAGGGTGCTTGCTTCCGGTTTGTCGGTTCAGGGAAG[C/T]AGTGCTTGCACCCTGTGTCCACTCAGCTGAGTAAACAGTTATGCTGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Missense 351 1384 8 35
Genomic Location (Zv9):
Chromosome 17 (position 22887140)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23037289
KASP Assay ID:
554-4034.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGTTTGTCGGTTCAGGGAAGCAGTGCTTGCACCCTGTGTCCACTCAGC[T/G]GAGTAAACAGYTATGCTGTTGTAGTGTGGGCAAGGCCTGGGGTCCTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23069
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 808 1384 22 35
Genomic Location (Zv9):
Chromosome 17 (position 22905403)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23055552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCGTCAATATCTTAGGGTCTTACCAGTGCAATTGCCCACAGGGGTA[T/G]AGACAAGTCAATAGCACCAGCTGCCTTGGTGAGATAATCCTACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23070
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 946 1384 26 35
Genomic Location (Zv9):
Chromosome 17 (position 22918737)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23068886
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCATTGTAATGAAAGAAAAGTAATGAAACACTTTTACTTGTCTGCA[G/A]ATGTGAATGAGTGTGAGCTTCTCGGTAATGTGTGTGGTGAAGCCACCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9759
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Essential Splice Site 1133 1384 30 35
Genomic Location (Zv9):
Chromosome 17 (position 22929284)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23079433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAYTGCAAATCTGGACTCTACTACGATGAGAGCAAAYTACAGTGTCTCGG[T/G]AAGAAACAAAAATCGCAGTCTAAACWAAAATGTTCATTAAGATTTTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23071
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079460 Nonsense 1138 1384 31 35
Genomic Location (Zv9):
Chromosome 17 (position 22931794)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 23081943
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTCTGTTTCTCTTTGTCTCTGATCTCTACAGACACTGATGAATGC[C/T]AAGATGAGGCAAAATGTAGAGATGGTGAATGCATGAACACATATGGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)
  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)
  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)
  • Immune response to smallpox vaccine (IL-6): Genome-wide analysis of polymorphisms associated with cytokine responses in smallpox vaccine recipients. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link